Lab 3

TERC and TERT

Telomeres are double stranded breaks (DBS) that can be seen as caps or “seals” at the end of chromosomes . Their main function is to stop DNA damage mechanisms and protect the chromosome (Ayouaz et al., 2008; Raynaud et al., 2008). The telomerase ribonucleoprotein is made up of two components, the telomerase RNA component (TERC) and telomerase reverse transcriptase (TERT). TERT is made up of two subunits while TERC is an RNA template (Bolzán and Bianchi, 2006).

For this analysis, 10 homologs of different species were used to observe the divergence of these two components. From the organisms that were used for this analysis, seven were mammals (Macaca mulatta, Homo sapiens, Equus caballus, Bos Taurus, Canis lupus familiaris, Sus scrofa and Oryctolagus cuniculus), one amphibian (Xenopus laevis) and two ciliates (Oxytricha trifallax and Euplotes eurystomus). The analysis for TERT was done at the DNA level because some features that may portray the divergence of TERT might not be visible at the protein level, such as point mutations. As for the parameters, since TERC is not translated the parameters did not really matter in this analysis thus they were kept the same as the program’s parameters (CLUSTALW in Biology Workbench). For TERT, the parameters were also kept the same as for TERC to avoid discrepancy with different parameters. However an alignment was run with a higher gap open penalty (30) and it did not make much of a difference for TERT thus the parameters were kept the same as TERC. Also, to obtain a diverging rate for both TERC and TERT, a distance matrix was run using CLUSTALDIS.

In terms of divergence, TERC had a higher evolving rate then TERT. For the two ciliates (Oxytricha trifallax and Euplotes eurystomu) their distance matrix for TERT was 0.372, while for TERC it was 0.442. The increase in the distance matrix of TERC portrayed a higher divergence rate than TERT. Also across species, TERC was also diverging faster; the distance matrix for Oryctolagus cuniculus and Euplotes eurystomus was 0.678 while for TERC it was 0.730. This was expected since TERC is not translated, thus it is more likely to obtain more substitutions. However, the divergence of TERT was lower due to its function as a reverse transcriptase.

In order to figure out the position of the functional domains for TERT and TERC, we could look at the regions that appeared to be conserved among all of the different species and the place where there were most repeats. Since TERT has two subunits, one possible domain might be from position 360 to 600 in reference to the human TERT DNA sequence (AF015950.1). The other functional domain for TERT might also be around the positions 2520 to 3420 from the perspective of the human TERT sequence. As for TERC, the functionally active region might probable be located around position 180 to 360 in reference to the human TERC sequence (NR_001566.1). This might be the best way to approximate the functional domains, though for TERT it might not be correct because there was always one sequence that did not align until much earlier or later in the alignment (See TERT Alignment). Also, in order to find the functional domain for TERT, it might have been better to use the protein alignment though it would have not been ideal to find the divergence rate.

Possible functional domain for TERT from alignment (TERT_ALIGN_.rtf):
CGCGGGGGCCCCCCCGAGGCCTTCACCACCAGCGTGCGCAGCTACCTGCC
CAACACGGTGACCGACGCACTGCGGGGGAGCGGGGCGTGGGGGCTGCTGC
TGCGCCGCGTGGGCGACGACGTGCTGGTTCACCTGCTGGCACGCTGCGCG
CTCTTTGTGCTGGTGGCTCCCAGCTGCGCCTACCAGGTGTGCGGGCCGCC
GCTGTA

Possible second functional domain for TERT from alignment (TERT_ALIGN_.rtf):
CTTCAAGAGCCACGTCTCTACCTTGACAGACCTC
CAGCCGTACATGCGACAGTTCGTGGCTCACCTGCAGGAGACCAGCCCGCT
GAGGGATGCCGTCGTCATCGAGCAGAGCTCCTCCCTGAATGAGGCCAGCA
GTGGCCTCTTCGACGTCTTCCTACGCTTCATGTGCCACCACGCCGTGCGC
ATCAGGGGCAAGTCCTACGTCCAGTGCCAGGGGATCCCGCAGGGCTCCAT
CCTCTCCACGCTGCTCTGCAGCCTGTGCTACGGCGACATGGAGAACAAGC
TGTTTGCGGGGATTCGGCGGGACGGGCTGCTCCTGCGTTTGGTGGATGAT
TTCTTGTTGGTGACACCTCACCTCACCCACGCGAAAACCTTCCTCAGGAC
CCTGGTCCGAGGTGTCCCTGAGTATGGCTGCGTGGTGAACTTGCGGAAGA
CAGTGGTGAACTTCCCTGTAGAAGACGAGGCCCTGGGTGGCACGGCTTTT
TACCCGGACCCTGGAGGTGCAGAGCGACTACTCCAGCTATGCCCGGACCT
ATGCGTCGCAAACTCTTTGGGGTCTTGCGGCTGAAGTGTCACAGCCTGTT
AGATCCTCCTGCTGCAGGCGTACAGGTTTCACGCATGTGTGCTGCAGCTC
CCATTTCATCAGCAAGTTTGGAAGAACCCCACATTTTTCCTGCGCGTCAT
CTCTGACACGGCCTCCCTCTGCTACTCCATCCTGAAAGCCAAGAACGCAG
GGATGTCGCTGGGGGCCAAGGGCGCCGCCGGCCCTCTGCCCTCCGAGGCC
GTGCAGTGGCTGTGCCACCAAGCATTCCTGCTCAAGCTGACTCGACACCG
TGTCACCTACGTGCCACTCCTGGGGTCACTCAGGACAGCCCAGACGCAGC
TGAGTCGGAAGCTCCCGGGGACGACGCTGACTGCCCTGGAGGCCGCAGCC

Possible functional domain for TERC from alignment (TERC_Align.rtf):
AAAATGTCAGCTGCTGGCCCGT
TCGCCCCTCCCGGGGACCTGCGGCGGGTCGCCTGCCCAGCCCCC-GAACC
CCGCCTGGAGGCCGCGGTCGGCCCGG—GGCTTCTCCGGAGGCACCCACT
GCCA—-CCGCGAAGAGTTGGGCTCTGTCAGCCGCGGGTCTCTCGGGGGC

Furthermore, the components do not appear to be evolving in clock-wise fashion because the two components had different diverging rates. If the two were evolving in a clock-wise fashion the distance matrix would have been the same for both and not higher for TERC.

ORGANISMS

Telomerase Reverse Transcriptase (TERT)

NM_001190967.1 - Macaca mulatta
AF015950.1 - Homo sapiens
FJ905322.1 - Equus caballus
NM_001046242.1 - Bos taurus
NM_001031630.1 - Canis lupus familiaris
AY785158.1 - Sus scrofa
NM_001085633.1 - Xenopus laevis
AF060230.1 - Oxytricha trifallax
AY445832.1 - Euplotes eurystomus
DQ399677.1 - Oryctolagus cuniculus

Telomerase RNA Component (TERC)

NR_001576.1 - Bos taurus
AF221920.1 - Sus scrofa
AY833720.1 - Canis familiaris
AF221918.1 - Oryctolagus cuniculus
NR_033816.1 - Macaca mulatta
NR_001566.1 - Homo sapiens ,
AF221925.1 - Equus caballus
NR_003556.1 - Xenopus laevis
OTU10568 - Oxytricha trifallax
U10566.1 - EEU10566 Euplotes eurystomus

ATTANCHMENTS

See FILES below

TERC_Align.rtf
TERT_ALIGN_.rtf
TERC_DISTANCE_MATRIX.png
TERT_DISTANCE_MATRIX.png

REFERENCES

Ayouaz et al. 2008. Telomeres: Hallmarks of radiosensitivity Review Article Biochimie. 90(1):60-72.
Raynaud et al. 2008. Telomere length, telomeric proteins and genomic instability during the multistep carcinogenic process. Critical Reviews in Oncology/Hematology. 66(2) : 99-117.
Bolzán A.D., Bianchi M.S. 2006. Telomeres, interstitial telomeric repeat sequences, and chromosomal aberrations. Mutation Research/Reviews in Mutation Research. 612(3): 189-214.